Questões do ENEM 2013
Questões aplicadas na prova de 2013, cada uma em página própria com enunciado, alternativas e gabarito.
Resultados
2.450 questões encontradas. Mostrando a página 55 de 123.
4E332760-AF TEXTHARVARD BUSINESS REVIEW calls data science “the sexiest job in the 21st century,” and by most accounts this hot new field promises to revolutionize industries from business to government, health care to academia.The field has been spawned by the enormous amounts of data that modern technologies create — be it the online behavior of Facebook users, tissue samples of cancer patients, purchasing habits of grocery shoppers or crime statistics of cities. Data scientists are the magicians of the Big Data era. They crunch the data, use mathematical models to analyze it and create narratives or visualizations to explain it, then suggest how to use the information to make decisions.In the last few years, dozens of programs under a variety of names have sprung up in response to the excitement about Big Data, not to mention the six-figure salaries for some recent graduates. In the fall, Columbia will offer new master’s and certificate programs heavy on data. The University of San Francisco will soon graduate its charter class of students with a master’s in analytics.Rachel Schutt, a senior research scientist at Johnson Research Labs, taught “Introduction to Data Science” last semester at Columbia (its first course with “data science” in the title). She described the data scientist this way: “a hybrid computer scientist software engineer statistician.” And added: “The best tend to be really curious people, thinkers who ask good questions and are O.K. dealing with unstructured situations and trying to find structure in them.”Eurry Kim, a 30-year-old “wannabe data scientist,” is studying at Columbia for a master’s in quantitative methods in the social sciences and plans to use her degree for government service. She discovered the possibilities while working as a corporate tax analyst at the Internal Revenue Service. She might, for example, analyze tax return data to develop algorithms that flag fraudulent filings, or cull national security databases to spot suspicious activity.Some of her classmates are hoping to apply their skills to e-commerce, where data about users’ browsing history is gold.“This is a generation of kids that grew up with data science around them — Netflix telling them what movies they should watch, Amazon telling them what books they should read — so this is an academic interest with real-world applications,” said Chris Wiggins, a professor of applied mathematics at Columbia who is involved in its new Institute for Data Sciences and Engineering. “And,” he added, “they know it will make them employable.”Universities can hardly turn out data scientists fast enough. To meet demand from employers, the United States will need to increase the number of graduates with skills handling large amounts of data by as much as 60 percent, according to a report by McKinsey Global Institute. There will be almost half a million jobs in five years, and a shortage of up to 190,000 qualified data scientists, plus a need for 1.5 million executives and support staff who have an understanding of data.Because data science is so new, universities are scrambling to define it and develop curriculums. As an academic field, it cuts across disciplines, with courses in statistics, analytics, computer science and math, coupled with the specialty a student wants to analyze, from patterns in marine life to historical texts.With the sheer volume, variety and speed of data today, as well as developing technologies, programs are more than a repackaging of existing courses. “Data science is emerging as an academic discipline, defined not by a mere amalgamation of interdisciplinary fields but as a body of knowledge, a set of professional practices, a professional organization and a set of ethical responsibilities,” said Christopher Starr, chairman of the computer science department at the College of Charleston, one of a few institutions offering data science at the undergraduate level.Most master’s degree programs in data science require basic programming skills. They start with what Ms. Schutt describes as the “boring” part — scraping and cleaning raw data and “getting it into a nice table where you can actually analyze it.” Many use data sets provided by businesses or government, and pass back their results. Some host competitions to see which student can come up with the best solution to a company’s problem.Studying a Web user’s data has privacy implications. Using data to decide someone’s eligibility for a line of credit or health insurance, or even recommending who they friend on Facebook, can affect their lives. “We’re building these models that have impact on human life,” Ms. Schutt said. “How can we do that carefully?” Ethics classes address these questions.Finally, students have to learn to communicate their findings, visually and orally, and they need business know-how, perhaps to develop new products.From: www.nytimes.com
As to the way academic institutions are reacting in response to the enormous need of professionals in the field of data science, the text informs that
4E2F0772-AF Inglês
Interpretação de texto | Reading comprehensionUECE · 2013DifícilEntre para guardar nos favoritosTEXTHARVARD BUSINESS REVIEW calls data science “the sexiest job in the 21st century,” and by most accounts this hot new field promises to revolutionize industries from business to government, health care to academia.The field has been spawned by the enormous amounts of data that modern technologies create — be it the online behavior of Facebook users, tissue samples of cancer patients, purchasing habits of grocery shoppers or crime statistics of cities. Data scientists are the magicians of the Big Data era. They crunch the data, use mathematical models to analyze it and create narratives or visualizations to explain it, then suggest how to use the information to make decisions.In the last few years, dozens of programs under a variety of names have sprung up in response to the excitement about Big Data, not to mention the six-figure salaries for some recent graduates. In the fall, Columbia will offer new master’s and certificate programs heavy on data. The University of San Francisco will soon graduate its charter class of students with a master’s in analytics.Rachel Schutt, a senior research scientist at Johnson Research Labs, taught “Introduction to Data Science” last semester at Columbia (its first course with “data science” in the title). She described the data scientist this way: “a hybrid computer scientist software engineer statistician.” And added: “The best tend to be really curious people, thinkers who ask good questions and are O.K. dealing with unstructured situations and trying to find structure in them.”Eurry Kim, a 30-year-old “wannabe data scientist,” is studying at Columbia for a master’s in quantitative methods in the social sciences and plans to use her degree for government service. She discovered the possibilities while working as a corporate tax analyst at the Internal Revenue Service. She might, for example, analyze tax return data to develop algorithms that flag fraudulent filings, or cull national security databases to spot suspicious activity.Some of her classmates are hoping to apply their skills to e-commerce, where data about users’ browsing history is gold.“This is a generation of kids that grew up with data science around them — Netflix telling them what movies they should watch, Amazon telling them what books they should read — so this is an academic interest with real-world applications,” said Chris Wiggins, a professor of applied mathematics at Columbia who is involved in its new Institute for Data Sciences and Engineering. “And,” he added, “they know it will make them employable.”Universities can hardly turn out data scientists fast enough. To meet demand from employers, the United States will need to increase the number of graduates with skills handling large amounts of data by as much as 60 percent, according to a report by McKinsey Global Institute. There will be almost half a million jobs in five years, and a shortage of up to 190,000 qualified data scientists, plus a need for 1.5 million executives and support staff who have an understanding of data.Because data science is so new, universities are scrambling to define it and develop curriculums. As an academic field, it cuts across disciplines, with courses in statistics, analytics, computer science and math, coupled with the specialty a student wants to analyze, from patterns in marine life to historical texts.With the sheer volume, variety and speed of data today, as well as developing technologies, programs are more than a repackaging of existing courses. “Data science is emerging as an academic discipline, defined not by a mere amalgamation of interdisciplinary fields but as a body of knowledge, a set of professional practices, a professional organization and a set of ethical responsibilities,” said Christopher Starr, chairman of the computer science department at the College of Charleston, one of a few institutions offering data science at the undergraduate level.Most master’s degree programs in data science require basic programming skills. They start with what Ms. Schutt describes as the “boring” part — scraping and cleaning raw data and “getting it into a nice table where you can actually analyze it.” Many use data sets provided by businesses or government, and pass back their results. Some host competitions to see which student can come up with the best solution to a company’s problem.Studying a Web user’s data has privacy implications. Using data to decide someone’s eligibility for a line of credit or health insurance, or even recommending who they friend on Facebook, can affect their lives. “We’re building these models that have impact on human life,” Ms. Schutt said. “How can we do that carefully?” Ethics classes address these questions.Finally, students have to learn to communicate their findings, visually and orally, and they need business know-how, perhaps to develop new products.From: www.nytimes.com
According to the text, besides being referred to as a sexy job in our century, data science
A044924A-AF Biologia
Esponjas e CnidáriosUECE · 2013FácilEntre para guardar nos favoritosSobre as esponjas, analise as afirmações abaixo.
I. Sua pequena capacidade regenerativa revela a elevada interdependência e a diferenciação de suas células.
II. Não possuem sistema digestório. A digestão é exclusivamente intracelular.
III. Todas possuem espículas silicosas distribuídas pelo corpo, que são urticantes e importantes para a defesa das espécies.
IV. Seus coanócitos criam uma corrente que faz a água circular no seu interior e sair pelo ósculo.
Está correto apenas o que se afirma em
A040828C-AF Biologia
Identidade dos seres vivosUECE · 2013FácilEntre para guardar nos favoritosConsidere as seguintes características de um ser vivo:
I. Tem a capacidade de evoluir ao longo do tempo.
II. Possui organização celular.
III. Apresenta material genético.
Os vírus possuem apenas a(s) característica(s)
A03BB56D-AF Biologia
FungosUECE · 2013FácilEntre para guardar nos favoritosEm uma consulta, o médico examina um bebê e observa inúmeros pontos brancos em sua mucosa bucal, mas tranquiliza a mãe da criança, dizendo que é um problema comum, conhecido como "sapinho", uma doença causada porA0228FB5-AF Biologia
Gimnospermas e AngiospermasUECE · 2013FácilEntre para guardar nos favoritosSementes são óvulos fertilizados e desenvolvidos que, embora apresentem diferenças morfológicas entre si, têm como função primordial a perpetuação e a multiplicação das espécies.
Atente para as seguintes afirmações a respeito das sementes.
I. A presença de substâncias nutritivas na semente é um fator que favorece a propagação dos vegetais.
II. A semente é uma estrutura vegetal importante, mas no caso das ervas daninhas, a plântula resultante da germinação estabelece uma relação de competição imediata e nociva com a planta-mãe.
III. As sementes são elementos essenciais para uma maior dispersão das espécies.
IV. Somente as sementes produzidas em frutos secos realizam a proteção mecânica do embrião.
Está correto o que se afirma apenas em
A01BF9C8-AF Biologia
Biomas brasileirosUECE · 2013FácilEntre para guardar nos favoritosAnalise as proposições a seguir e assinale com V as verdadeiras e com F as falsas.
( ) À medida que os ambientes são mais amplamente estudados, espécies novas são catalogadas. No entanto, muitas delas são extintas antes mesmo de serem descobertas.
( ) A biodiversidade brasileira é uma das maiores do mundo e vem aumentando ano a ano devido à fragmentação de ambientes naturais.
( ) As angiospermas, plantas que produzem sementes, mas não frutos, são o grupo mais diverso e rico dentre todas as plantas.
( ) De acordo o Ministério do Meio Ambiente, dentre os biomas brasileiros com maior número de espécies ameaçadas de extinção estão: a Mata Atlântica, o Cerrado e a Caatinga, nessa ordem.
Está correta, de cima para baixo, a seguinte sequência:
A016E6E2-AF Biologia
Ecologia e ciências ambientaisUECE · 2013MédioEntre para guardar nos favoritosQuanto às questões de crise ecológica e sustentabilidade que afetam o mundo e, principalmente, as relações internacionais, é correto afirmar-se queA013B59A-AF Biologia
Biomas brasileirosUECE · 2013MédioEntre para guardar nos favoritos“No Brasil, não existem desertos, mas uma região semiárida, com características e espécies únicas. A caatinga é o único bioma restrito ao território brasileiro, ocupando basicamente a Região Nordeste, com algumas áreas no Estado de Minas Gerais. A vegetação da Caatinga não apresenta a exuberância verde das florestas tropicais úmidas e o aspecto seco das fisionomias dominadas por cactos e arbustos sugere uma baixa diversificação da fauna e da flora. Para desvendar sua riqueza, é necessário um olhar mais atento, mais aberto. Assim ela revela sua grande biodiversidade, sua relevância biológica e sua beleza peculiar.”LEAL, Inara e colaboradores, Ecologia e Conservação da Caatinga. 2013.Sobre o bioma caatinga, é correto afirmar-se queA00F465A-AF Biologia
Hereditariedade e diversidade da vidaUECE · 2013MédioEntre para guardar nos favoritosEm situações problemas relacionadas à genética mendeliana, um dos cálculos probabilísticos utilizados é a aplicação da denominada “regra da adição” para o cálculo da probabilidade da ocorrência de eventos mutuamente exclusivos. A partir dessa informação, indique entre as opções abaixo a fração que representa a chance de um casal de pele normal, portador de gene para albinismo ter dois filhos, de qualquer sexo, sendo o primeiro de pele normal e o outro albino ou ambos normais.A00C3C0F-AF Biologia
Biomas brasileirosUECE · 2013FácilEntre para guardar nos favoritosDois exemplos de ecossistemas cujas plantas apresentam xeromorfismo aparente, como resposta à falta de água e à deficiência de nutrientes no solo, respectivamente, são:A007AD9D-AF Biologia
Identidade dos seres vivosUECE · 2013MédioEntre para guardar nos favoritosCaracterísticas como simetria bilateral, presença de três folhetos germinativos, cavidade digestória completa com boca e ânus, cavidade corporal e metameria destacaram-se durante a história evolutiva dos animais. Da ocorrência destas características entre os diversos grupos animais, marque a afirmação correta.A0034716-AF Biologia
A química da vidaUECE · 2013FácilEntre para guardar nos favoritosO ácido L-ascórbico apresenta grande importância para sistemas bioquímicos, farmacológicos, eletroquímicos, processamento de alimentos e outros, sendo suas propriedades redox uma das características químicas de maior interesse. Sobre esse ácido, é correto afirmar-se que9FFBCAC7-AF Biologia
A química da vidaUECE · 2013DifícilEntre para guardar nos favoritosO corpo humano produz milhares de proteínas diferentes que, no organismo, possuem funções também diferentes, como por exemplo: estruturais, catalíticas, contrácteis, transportadoras, de defesa imunológica, etc, estando o formato de cada proteína diretamente relacionado com a sua função. Quanto à estrutura e à função das proteínas, indique a afirmação correta.9FF85C72-AF Biologia
A química da vidaUECE · 2013FácilEntre para guardar nos favoritosAnalise as seguintes afirmações a respeito das substâncias que compõem os seres vivos:
I. Vitaminas são as melhores fontes de energia para os seres vivos, mas somente são encontradas nos alimentos saudáveis.
II. Além de sua função energética, os carboidratos também atuam como elementos estruturais e de proteção nos seres vivos.
III. Alguns hormônios sexuais dependem da existência de gordura para um funcionamento ideal.
IV. Seres vivos são constituídos exclusivamente por substâncias orgânicas como proteínas, lipídios, carboidratos, vitaminas e ácidos nucleicos.
Está correto o que se afirma apenas em
9FF4C130-AF Biologia
Moléculas, células e tecidosUECE · 2013MédioEntre para guardar nos favoritosA anemia falciforme decorre de uma mutação específica no gene da beta-globina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.1ª Sequência normal da hemoglobina: ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTAC TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT2ª Sequência da hemoglobina com a mutação – anemia falciforme: ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTAC TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTPara a tradução desses genes, é (são) necessário(s)1AB85904-AF Inglês
Interpretação de texto | Reading comprehensionUECE · 2013DifícilEntre para guardar nos favoritosTEXT
Hundreds of studies have assessed leadership styles, mainly by having employees report on how their managers typically behave. Researchers have also collected information on how effective managers are. After large numbers of such studies became available, reviewers aggregated them quantitatively to discover what kinds of leadership are effective.
One conclusion that has emerged based on the research of the past 30 years is that a hybrid style known as transformational leadership is highly effective in most contemporary organizational contexts.
A transformational leader acts as an inspirational role model, motivates others to go beyond the confines of their job descriptions, encourages creativity and innovation, fosters good human relationships, and develops the skills of followers. This type of leadership is effective because it fosters strong interpersonal bonds based on a leader’s charisma and consideration of others. These bonds enable leaders to promote high-quality performance by encouraging workers rather than threatening them, thus motivating them to exceed basic expectations.
By bringing out the best in others, transformational leaders enhance the performance of groups and organizations.
Transformational leadership is androgynous because it incorporates culturally masculine and feminine behaviors. This androgynous mixing of the masculine and feminine means that skill in this contemporary way of leading does not necessarily come naturally. It may require some effort and thought.
Men often have to work on their social skills and women on being assertive enough to inspire others. It is nonetheless clear that both women and men can adapt to the demands of leadership in the transformational mode.
One of the surprises of research on transformational leadership is that female managers are somewhat more transformational than male managers. In particular, they exceed men in their attention to human relationships. Also, in delivering incentives, women lean toward a more positive, reward-based approach and men toward a more negative and less effective, threat-based approach. In these respects, women appear to be better leaders than men, despite the double standard that can close women out of these roles.
Why are women leaders more transformational when they are less likely to become leaders in the first place? One reason is that the double standard that slows women’s rise would work against mediocre women while allowing mediocre men to rise. As a consequence, the women who attain leadership roles really are better than the men on average.
It is also true women generally avoid more domineering, “command and control” behavior because of the backlash they receive if they lead in this way. Men can often get away with autocratic behavior that is roundly disliked in women. Ironically, this backlash against domineering women may foster good leadership because the androgynous middle ground is more likely to bring success. Leaders gain less from ordering others about than from forming teams of smart, motivated collaborators who together figure out how to solve problems and get work done.
From: http://www.nytimes.com/ 2013/03/20
Women usually refuse to behave in a domineering way due to the fact that they1AB5550E-AF Inglês
Interpretação de texto | Reading comprehensionUECE · 2013Muito difícilEntre para guardar nos favoritosTEXT
Hundreds of studies have assessed leadership styles, mainly by having employees report on how their managers typically behave. Researchers have also collected information on how effective managers are. After large numbers of such studies became available, reviewers aggregated them quantitatively to discover what kinds of leadership are effective.
One conclusion that has emerged based on the research of the past 30 years is that a hybrid style known as transformational leadership is highly effective in most contemporary organizational contexts.
A transformational leader acts as an inspirational role model, motivates others to go beyond the confines of their job descriptions, encourages creativity and innovation, fosters good human relationships, and develops the skills of followers. This type of leadership is effective because it fosters strong interpersonal bonds based on a leader’s charisma and consideration of others. These bonds enable leaders to promote high-quality performance by encouraging workers rather than threatening them, thus motivating them to exceed basic expectations.
By bringing out the best in others, transformational leaders enhance the performance of groups and organizations.
Transformational leadership is androgynous because it incorporates culturally masculine and feminine behaviors. This androgynous mixing of the masculine and feminine means that skill in this contemporary way of leading does not necessarily come naturally. It may require some effort and thought.
Men often have to work on their social skills and women on being assertive enough to inspire others. It is nonetheless clear that both women and men can adapt to the demands of leadership in the transformational mode.
One of the surprises of research on transformational leadership is that female managers are somewhat more transformational than male managers. In particular, they exceed men in their attention to human relationships. Also, in delivering incentives, women lean toward a more positive, reward-based approach and men toward a more negative and less effective, threat-based approach. In these respects, women appear to be better leaders than men, despite the double standard that can close women out of these roles.
Why are women leaders more transformational when they are less likely to become leaders in the first place? One reason is that the double standard that slows women’s rise would work against mediocre women while allowing mediocre men to rise. As a consequence, the women who attain leadership roles really are better than the men on average.
It is also true women generally avoid more domineering, “command and control” behavior because of the backlash they receive if they lead in this way. Men can often get away with autocratic behavior that is roundly disliked in women. Ironically, this backlash against domineering women may foster good leadership because the androgynous middle ground is more likely to bring success. Leaders gain less from ordering others about than from forming teams of smart, motivated collaborators who together figure out how to solve problems and get work done.
From: http://www.nytimes.com/ 2013/03/20
As to the effectiveness of managers, researchers have found, after many years of study, that1AB18C60-AF Inglês
Interpretação de texto | Reading comprehensionUECE · 2013DifícilEntre para guardar nos favoritosTEXT
Hundreds of studies have assessed leadership styles, mainly by having employees report on how their managers typically behave. Researchers have also collected information on how effective managers are. After large numbers of such studies became available, reviewers aggregated them quantitatively to discover what kinds of leadership are effective.
One conclusion that has emerged based on the research of the past 30 years is that a hybrid style known as transformational leadership is highly effective in most contemporary organizational contexts.
A transformational leader acts as an inspirational role model, motivates others to go beyond the confines of their job descriptions, encourages creativity and innovation, fosters good human relationships, and develops the skills of followers. This type of leadership is effective because it fosters strong interpersonal bonds based on a leader’s charisma and consideration of others. These bonds enable leaders to promote high-quality performance by encouraging workers rather than threatening them, thus motivating them to exceed basic expectations.
By bringing out the best in others, transformational leaders enhance the performance of groups and organizations.
Transformational leadership is androgynous because it incorporates culturally masculine and feminine behaviors. This androgynous mixing of the masculine and feminine means that skill in this contemporary way of leading does not necessarily come naturally. It may require some effort and thought.
Men often have to work on their social skills and women on being assertive enough to inspire others. It is nonetheless clear that both women and men can adapt to the demands of leadership in the transformational mode.
One of the surprises of research on transformational leadership is that female managers are somewhat more transformational than male managers. In particular, they exceed men in their attention to human relationships. Also, in delivering incentives, women lean toward a more positive, reward-based approach and men toward a more negative and less effective, threat-based approach. In these respects, women appear to be better leaders than men, despite the double standard that can close women out of these roles.
Why are women leaders more transformational when they are less likely to become leaders in the first place? One reason is that the double standard that slows women’s rise would work against mediocre women while allowing mediocre men to rise. As a consequence, the women who attain leadership roles really are better than the men on average.
It is also true women generally avoid more domineering, “command and control” behavior because of the backlash they receive if they lead in this way. Men can often get away with autocratic behavior that is roundly disliked in women. Ironically, this backlash against domineering women may foster good leadership because the androgynous middle ground is more likely to bring success. Leaders gain less from ordering others about than from forming teams of smart, motivated collaborators who together figure out how to solve problems and get work done.
From: http://www.nytimes.com/ 2013/03/20
Among the factors that make transformational leadership effective, the text mentions1AAD3F7D-AF Inglês
Interpretação de texto | Reading comprehensionUECE · 2013Muito difícilEntre para guardar nos favoritosTEXT
Hundreds of studies have assessed leadership styles, mainly by having employees report on how their managers typically behave. Researchers have also collected information on how effective managers are. After large numbers of such studies became available, reviewers aggregated them quantitatively to discover what kinds of leadership are effective.
One conclusion that has emerged based on the research of the past 30 years is that a hybrid style known as transformational leadership is highly effective in most contemporary organizational contexts.
A transformational leader acts as an inspirational role model, motivates others to go beyond the confines of their job descriptions, encourages creativity and innovation, fosters good human relationships, and develops the skills of followers. This type of leadership is effective because it fosters strong interpersonal bonds based on a leader’s charisma and consideration of others. These bonds enable leaders to promote high-quality performance by encouraging workers rather than threatening them, thus motivating them to exceed basic expectations.
By bringing out the best in others, transformational leaders enhance the performance of groups and organizations.
Transformational leadership is androgynous because it incorporates culturally masculine and feminine behaviors. This androgynous mixing of the masculine and feminine means that skill in this contemporary way of leading does not necessarily come naturally. It may require some effort and thought.
Men often have to work on their social skills and women on being assertive enough to inspire others. It is nonetheless clear that both women and men can adapt to the demands of leadership in the transformational mode.
One of the surprises of research on transformational leadership is that female managers are somewhat more transformational than male managers. In particular, they exceed men in their attention to human relationships. Also, in delivering incentives, women lean toward a more positive, reward-based approach and men toward a more negative and less effective, threat-based approach. In these respects, women appear to be better leaders than men, despite the double standard that can close women out of these roles.
Why are women leaders more transformational when they are less likely to become leaders in the first place? One reason is that the double standard that slows women’s rise would work against mediocre women while allowing mediocre men to rise. As a consequence, the women who attain leadership roles really are better than the men on average.
It is also true women generally avoid more domineering, “command and control” behavior because of the backlash they receive if they lead in this way. Men can often get away with autocratic behavior that is roundly disliked in women. Ironically, this backlash against domineering women may foster good leadership because the androgynous middle ground is more likely to bring success. Leaders gain less from ordering others about than from forming teams of smart, motivated collaborators who together figure out how to solve problems and get work done.
From: http://www.nytimes.com/ 2013/03/20
Further exploring the apparently paradoxical reasons why women leaders are more successful in transformational leadership than men, the text mentions the fact that